Tissues - PDFSEARCH.IO - Document Search Engine

Tissues
Results: 1945

#	Item
251	Int. J. BiosciInternational Journal of Biosciences (IJB) ISSN: PrintOnline) Vol. 1, No. 4, p, 2011 Add to Reading List Source URL: www.innspub.net Language: English - Date: 2012-07-12 12:03:48 Obesity Tissues Peptide hormones Diabetes Nutrition Resistin Abdominal obesity Metabolic syndrome Adipose tissue Biology Anatomy Health
252	Microsoft Word - Document5 Add to Reading List Source URL: ganymede.meccahosting.com Language: English - Date: 2014-01-28 02:05:36 Anatomy Nutrition Obesity Exercise physiology Tissues Low-carbohydrate diet Dieting Muscle Weight loss Health Diets Biology
253	34th HKOA Congress, 2014 Free Paper Session 5 — Basic Science 5.1 T2 Mapping is a Better Imaging Biomarker than T1rho in Cartilage Degeneration in Knee Add to Reading List Source URL: hkoa.org Language: English - Date: 2014-11-01 11:35:47 Medicine Animal physiology Osteology Tissues Stem cells Bone Tendon Collagen Orthopedic surgery Biology Anatomy Skeletal system
254	Appendix 5: Florida Classification Florida Hospital Adverse Event/Harm Categories & Sub-Categories Events Related to Medication/Intravenous Fluids Clostridium difficile medication associated infection IV volume overlo Add to Reading List Source URL: www.hqsc.govt.nz Language: English - Date: 2014-11-27 16:19:14 Hematology Tissues Surgery Intravenous therapy Catheter Bleeding Bacteremia Book:Critical Care: An Introduction Epidural Medicine Dosage forms Blood
255	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
256	Journal of Exercise Science and Fitness (2003), 1(1): 9-17 Add to Reading List Source URL: www.fmshk.org Language: English - Date: 2006-06-28 06:40:47 Peptide hormones Exercise physiology Muscular system Tissues Insulin-like growth factor 1 receptor Insulin-like growth factor Hypertrophy Myosatellite cell IGF Biology Anatomy Growth factors
257	• Ideal for peripheral tissues as well CMA 31 Microdialysis Linear Probe as for tumors • Daltons cut-off membrane Add to Reading List Source URL: www.ashmed.com.au Language: English - Date: 2012-10-24 22:58:36 Cell biology Microdialysis Medical equipment Thermoplastics Syringe Dialysis Polyimide Tubing Luer taper Chemistry Membrane technology Biology
258	Journal of Exercise Science and Fitness (2003), 1(1): 9-17 Add to Reading List Source URL: www.fmshk.org Language: English - Date: 2006-06-28 06:40:48 Exercise Athletic training Muscle Tissues Cross education Electrical muscle stimulation Strength training Exercise physiology Physical strength Anatomy Muscular system Biology
259	Professor Danny CHAN Department of Biochemistry, Li Ka Shing Faculty of Medicine The University of Hong Kong Biography Professor Danny Chan is a professor at Department of Biochemistry in Li Ka Shing Faculty of Medicine, Add to Reading List Source URL: www.cpao.hku.hk Language: English - Date: 2014-04-03 23:27:25 Danny Chan Li Ka Shing Faculty of Medicine University of Hong Kong Education in Hong Kong Structure Cartilage Skeletal system Tissues
260	Journal of Exercise Science and Fitness (2003), 1(1): 9-17 Add to Reading List Source URL: fmshk.org Language: English - Date: 2006-06-28 06:40:47 Peptide hormones Exercise physiology Muscular system Tissues Insulin-like growth factor 1 receptor Insulin-like growth factor Hypertrophy Myosatellite cell IGF Biology Anatomy Growth factors

UPDATE