Succinate dehydrogenase - PDFSEARCH.IO - Document Search Engine

Succinate dehydrogenase
Results: 11

#	Item
1	ISP2014 Poster Presentations (Updated) Registration ID Date Time Add to Reading List Source URL: www.isp2014.jp Language: English - Date: 2015-02-07 05:36:31 Clinical medicine Health Medicine Tumor suppressor genes Hereditary cancers Adrenal gland disorders Pheochromocytoma Paraganglioma SDHD SDHB Multiple endocrine neoplasia Succinate dehydrogenase
2	Aspuria et al. Cancer & Metabolism 2014, 2:21 http://www.cancerandmetabolism.com/contentCancer & Metabolism Add to Reading List Source URL: www.cancerandmetabolism.com Language: English Genes Tumor suppressor genes Developmental biology Cellular respiration SDHB SDHD SDHA Succinate dehydrogenase Pheochromocytoma Biology Medicine Oncology
3	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
4	Additional file 4: Table S4: List of gene nodes in the gene network having peroxisome proliferater-activated receptor (PPAR)-related genes as highly connected nodes (FigureGene Symbol Description ATP5C1 ATP synth Add to Reading List Source URL: ccforum.com Language: English Cellular respiration Glycolysis NADH dehydrogenase NDUFA2 NDUFA5 NDUFS2 Peroxisome proliferator-activated receptor gamma Succinate dehydrogenase complex subunit C Peroxisome proliferator-activated receptor alpha Biology Intracellular receptors Transcription factors
5	FRAG-UK statement on SDHI fungicides and resistance risk in cereals April 2014 The Succinate Dehydrogenase Inhibitor fungicides (SDHIs) are broad spectrum and highly effective against barley and wheat diseases. The SDHIs Add to Reading List Source URL: www.pesticides.gov.uk Language: English - Date: 2015-03-26 11:22:35 Mycology Agriculture Epoxiconazole Wheat diseases Mycosphaerella graminicola Pyrenophora teres Spot blotch QoI Biology Microbiology Fungicides
6	Citation: Cell Death and Disease[removed], e222; doi:[removed]cddis[removed] & 2011 Macmillan Publishers Limited All rights reserved[removed]www.nature.com/cddis Review Add to Reading List Source URL: www.nature.com Language: English - Date: 2011-10-27 05:59:35 Integral membrane proteins NADH dehydrogenase Oxidative phosphorylation Succinate dehydrogenase Coenzyme Q – cytochrome c reductase Electron transport chain Mitochondrial DNA Mitochondrion Q cycle Biology Cellular respiration Biochemistry
7	Store at -20°C SDHA Antibody #5839 Add to Reading List Source URL: media.cellsignal.com Language: English - Date: 2015-02-24 12:44:15 Immunologic tests Glycoproteins Genes Tumor suppressor genes SDHA SDHB SDHD Succinate dehydrogenase Immunohistochemistry Biology Anatomy Immune system
8	Welcome to MitoMatters, the official newsletter for the Mitochondria Research Society-MRS Add to Reading List Source URL: mitoresearch.org Language: English - Date: 2002-02-06 20:38:09 Mitochondrial diseases Rare diseases Cellular respiration Mitochondrion Kearns–Sayre syndrome Mitochondrial DNA Succinate dehydrogenase National Institutes of Health Mitochondrial Eve Genetics Biology Health
9	Antioxidant enzyme overexpression protects cells with a mutation in succinate dehydrogenase subunit C (SDHC) from low dose irradiation radiation. Add to Reading List Source URL: lowdose.energy.gov Language: English - Date: 2012-02-28 18:10:24 Antioxidants Anions Metalloproteins Oxidoreductases Superoxide dismutase SOD2 Superoxide Catalase Oxidative stress Chemistry Biology Free radicals
10	Enzyme Catalysis and Regulation: 3-Nitropropionic Acid Is a Suicide Inhibitor of Mitochondrial Respiration Add to Reading List Source URL: www.jbc.org Language: English Proteins Cellular respiration Integral membrane proteins Protein domains EC 1.3 Succinate dehydrogenase Fumarate reductase Flavoprotein Fumarase Biology Biochemistry Chemistry

UPDATE