IRF3

IRF3
Results: 3

#	Item
1	www.sciencesignaling.org/cgi/content/fullra70/DC1 Supplementary Materials for Innate immune memory and homeostasis may be conferred through crosstalk between the TLR3 and TLR7 pathways Bing Liu, Qian Liu, Lei Yan Add to Reading List Source URL: www.dbs.nus.edu.sg Language: English - Date: 2016-07-13 04:45:39 Proteins TRIF FADD IRF3 MAP3K7IP3 IRAK1 TANK-binding kinase 1 TNF receptor associated factor MAP3K7IP2 Mitogen-activated protein kinase kinase TLR7 TRAF6
2	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
3	Symbol GeneID Probeset Cluster TRANSFAC matrices Ahr 11622 1422631_at 11 AHRARNT_01, AHRARNT_02, AHRHIF_Q6, AHR_01, AHR_Q5 Atf1 11908 1417296_at 14 ATF1_Q6, CREBATF_Q6, CREB_Q3 Atf3 11910 1449363_at 25 ATF3_Q6, CREBATF_Q Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English IRF7 IRF3 NFAT STAT1 FOXM1 FOX proteins RFX5 IRF5 HMGA2 Transcription factors Biology IRF2