IRF3

Results: 3



#Item
1Proteins / TRIF / FADD / IRF3 / MAP3K7IP3 / IRAK1 / TANK-binding kinase 1 / TNF receptor associated factor / MAP3K7IP2 / Mitogen-activated protein kinase kinase / TLR7 / TRAF6

www.sciencesignaling.org/cgi/content/fullra70/DC1 Supplementary Materials for Innate immune memory and homeostasis may be conferred through crosstalk between the TLR3 and TLR7 pathways Bing Liu, Qian Liu, Lei Yan

Add to Reading List

Source URL: www.dbs.nus.edu.sg

Language: English - Date: 2016-07-13 04:45:39
2Transcription factors / SDHA / Succinate dehydrogenase / IRF3 / Glutamate dehydrogenase 1 / Interferon regulatory factors / Glutamic acid / Dehydrogenase / CD36 / Chemistry / Biology / Biochemistry

Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length(bp) β-actin forward: GAGAAATTGTGCGTGACATCA

Add to Reading List

Source URL: proteomesci.com

Language: English
3IRF7 / IRF3 / NFAT / STAT1 / FOXM1 / FOX proteins / RFX5 / IRF5 / HMGA2 / Transcription factors / Biology / IRF2

Symbol GeneID Probeset Cluster TRANSFAC matrices Ahr 11622 1422631_at 11 AHRARNT_01, AHRARNT_02, AHRHIF_Q6, AHR_01, AHR_Q5 Atf1 11908 1417296_at 14 ATF1_Q6, CREBATF_Q6, CREB_Q3 Atf3 11910 1449363_at 25 ATF3_Q6, CREBATF_Q

Add to Reading List

Source URL: www.ncbi.nlm.nih.gov

Language: English
UPDATE