S2

Results: 2757



#Item
611Liquid fuels / Petroleum products / Technology / Flight planning / Fuel cell / Power / Thrust specific fuel consumption / Energy

DOCSYS - A Method to Evaluate Aircraft Systems D. Scholz SCHOLZ, Dieter: DOCsys - A Method to Evaluate Aircraft Systems. In: SCHMITT, D. (Hrsg.): Bewertung von Flugzeugen (Workshop: DGLR Fachausschuß S2 - Luftfahrtsyste

Add to Reading List

Source URL: www.fzt.haw-hamburg.de

Language: English - Date: 2004-05-05 20:36:23
612Broadcasting / Television technology / Digital television / High-definition television / DVB-T2 / DVB-T / DVB-S2 / DVB-H / Transposer / DVB / Electronic engineering / Broadcast engineering

www.screen.it SDT ARK-6 ULTRA HE SERIES Screen is a worldwide known company focused on turn key and end-to-end solutions for all broadcaster needs.

Add to Reading List

Source URL: www.screen.it

Language: English - Date: 2014-05-30 14:13:00
613Technology / Image scanner / Hewlett-Packard / Computing / Computer hardware / Office equipment

Scanjet Enterprise Flow 5000 s2 Sheet-feed Scanner Abandon paper-based workflows. Advance office efficiency with fast, intuitive scanning that turns hard copies into useful digital data. Rely on clear, legible results fr

Add to Reading List

Source URL: store.hp.com

Language: English - Date: 2014-08-12 21:53:16
614Hong Kong / Address / Kilogram / Cheque / Measurement / Units of mass / Ton

- < PAGE >Form S2-2ASpec.DOC]

Add to Reading List

Source URL: www.cwc.tid.gov.hk

Language: English - Date: 2012-11-21 03:10:39
615High-definition television / Broadcast engineering / Digital television / Television technology / DVB / DVB-S2 / H.264/MPEG-4 AVC / Electronic news-gathering / Serial digital interface / Electronic engineering / Television / Electronics

Compact Satellite News Gathering System for Small Vehicles Get to the scene quickly. Start broadcasting immediately. Compact, low-power SNG system with satellite auto-tracking for fast onsite broadcasting.

Add to Reading List

Source URL: www.mitsubishielectric.com

Language: English - Date: 2011-09-30 01:10:23
616Perl / Locale / Unix / S2 / Perl module / C localization functions / Filesystem Hierarchy Standard / Computing / Software / Internationalization and localization

Perl versiondocumentation - I18N::Collate NAME I18N::Collate - compare 8-bit scalar data according to the current locale SYNOPSIS

Add to Reading List

Source URL: perldoc.perl.org

Language: English - Date: 2014-10-03 15:46:37
617

WYŻSZA SZKOŁA INFORMATYKI, ZARZĄDZANIA I ADMINISTRACJI w WARSZAWIE FORMULARZ ZGŁOSZENIOWY Szkolenie S2 "Promocja i komunikacja" A. Dane personalne

Add to Reading List

Source URL: www.dobrauczelnia.pl

Language: Polish - Date: 2015-04-14 06:26:12
    618HTML / Accounting systems / Attribute grammar / Compiler construction / Attribute domain / Debits and credits / Account / Computing / Database theory / Programming paradigms

    Bulletin NoTo: Heads of Government Departments, Agencies, and Others Concerned Subject: Change to Transmittal Letter No. S2 14-01, U.S. Government Standard General Ledger (USSGL) – A Treasury Financial Manua

    Add to Reading List

    Source URL: tfm.fiscal.treasury.gov

    Language: English - Date: 2015-02-13 09:52:21
    619

    Microsoft Word - Form_S2-3X_2005_.doc

    Add to Reading List

    Source URL: www.cwc.tid.gov.hk

    Language: Korean - Date: 2012-11-21 03:22:11
      620Transcription factors / SDHA / Succinate dehydrogenase / IRF3 / Glutamate dehydrogenase 1 / Interferon regulatory factors / Glutamic acid / Dehydrogenase / CD36 / Chemistry / Biology / Biochemistry

      Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length(bp) β-actin forward: GAGAAATTGTGCGTGACATCA

      Add to Reading List

      Source URL: proteomesci.com

      Language: English
      UPDATE