Interferon - PDFSEARCH.IO - Document Search Engine

Interferon
Results: 1306

#	Item
91	Hepatitis C Testing Information © Hepatitis Australia 2010 Add to Reading List Source URL: hepqld.asn.au Language: English - Date: 2013-04-15 23:31:31 Hepatitis Viral diseases Hepatocellular carcinoma Cirrhosis Virus Liver cancer Infection Interferon Viral hepatitis Medicine Health Hepatology
92	Response and Recovery in the Plasma Metabolome Tracks the Acute LCMV-Induced Immune Response William R. Wikoff,,† Ewa Kalisak,† Sunia Trauger,† Marianne Manchester,‡ and Gary Siuzdak,† Department of Molecular Add to Reading List Source URL: masspec.scripps.edu Language: English - Date: 2013-12-10 15:01:45 Metabolism Antivirals Cytokines Immune system Immunology Metabolomics Neopterin Lymphocytic choriomeningitis Interferon Biology Chemistry Anatomy
93	Women Infoline: Design direction Add to Reading List Source URL: hepqld.asn.au Language: English - Date: 2013-04-15 23:31:58 Viral diseases Viruses Hepatitis Viral hepatitis Hepatology Infection Liver biopsy Interferon Hepatitis X Medicine Health Biology
94	236 IL-6 in a rat mononeuropathy model. Journal of Interferon and Cytokine Research, 16, 695–700. Maier, S.F., & Watkins, L.RThe immune system as a sensory system: Implications for psychology. Current Directi Add to Reading List Source URL: psychcentral.com Language: English - Date: 2009-02-12 07:34:22 Human behavior Therapy Animal-assisted therapy Stress Dog Pets for Vets Biology Zoology Pets
95	MAKING DECISIONS ABOUT HEPATITIS C TREATMENT My Normal GP To Prevent Long Term Liver Damage Add to Reading List Source URL: hepqld.asn.au Language: English - Date: 2013-04-15 23:27:26 Hepatology Hepatitis Cytokines Interferon Ribavirin Liver biopsy Cirrhosis Viral hepatitis Hepatitis B Medicine Antivirals Health
96	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
97	Clinical Commissioning Policy: Clinical Commissioning Policy: Add to Reading List Source URL: www.england.nhs.uk Language: English - Date: 2014-08-12 08:05:41 Medicine Immunosuppressants Autoimmune diseases Neurological disorders Glatiramer acetate Natalizumab Fingolimod McDonald criteria Interferon Immunology Multiple sclerosis Immune system
98	letters Alopecia areata is driven by cytotoxic T lymphocytes and is reversed by JAK inhibition Luzhou Xing1,7, Zhenpeng Dai2,7, Ali Jabbari2,7, Jane E Cerise2,3, Claire A Higgins2, Weijuan Gong2, Annemieke de Jong2, Siv Add to Reading List Source URL: www.aaaf.org.au Language: English - Date: 2014-08-17 18:33:37 Anatomy Cytokines Alopecia areata CD8+ cell T helper cell Interferon-gamma Interleukin CD8 CD25 Biology Immune system T cells
99	Mandatory Specialty Drug List Drug Name Generic Name Abraxane Add to Reading List Source URL: www.lifewisewa.com Language: English - Date: 2015-04-29 12:03:39 Pharmacology Cytokines Protease inhibitors Coagulation system Recombinant proteins Interferon Ribavirin LifeWise Health Plan of Oregon Telaprevir Biology Medicine Antivirals
100	Recovery from hepatitis C treatments MONOGRAPHRecovery Add to Reading List Source URL: hepqld.asn.au Language: English - Date: 2013-04-15 23:28:38 Biology Antivirals Sexually transmitted diseases and infections Hepatitis C HIV Hepatitis Infection Interferon Ribavirin Medicine Health HIV/AIDS

UPDATE