Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA - CD36 - Document - PDFSEARCH.IO

First Page	Meta Content
	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Open Document File Size: 22,84 KB Share Result on Facebook SocialTag Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry

Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCAAdd to Reading List