Broiler - PDFSEARCH.IO - Document Search Engine

Broiler
Results: 1129

#	Item
111	CS150 BP&N Supp:12 Add to Reading List Source URL: www.cobb-vantress.com Language: English - Date: 2014-09-04 10:58:15 Medicine Broiler Vitamin B12 Vitamin A Riboflavin Methionine Vitamin K Vitamin Pantothenic acid Nutrition B vitamins Chemistry
112	For Immediate Release U.S. Poultry & Egg Association Contact Gwen Venable, , Research Holds Promise for Controlling Kinky Back Disease in Broilers Add to Reading List Source URL: www.uspoultry.org Language: English - Date: 2015-05-05 09:56:06 Food and drink Poultry farming U.S. Poultry & Egg Association Broiler
113	The University of Georgia Cooperative Extension Service College of Agricultural and Environmental Sciences / Athens, GeorgiaJANUARY 2010 Add to Reading List Source URL: www.poultry.uga.edu Language: English - Date: 2010-04-20 13:33:18 Chicken Ornithology Broiler Bird Cat Disinfectant Influenza Zoology Biology Poultry farming
114	Int. J. BiosciInternational Journal of Biosciences (IJB) ISSN: PrintOnline) Vol. 2, No. 7, p, 2012 Add to Reading List Source URL: www.innspub.net Language: English - Date: 2012-07-22 10:57:40 Health sciences Self-care Personal life Knowledge Broiler Nutrition Human nutrition Applied sciences Food science Health
115	What’s Wrong with HighWelfare Animal Products? Meat, milk and eggs produced under so-called ‘higher welfare’ schemes – including Freedom Food, free-range and organic – have become increasingly popular amongst c Add to Reading List Source URL: www.animalaid.org.uk Language: English - Date: 2009-07-06 07:41:49 Livestock Meat industry Animal rights Animal welfare Free range Factory farming Pig farming Domestic pig Broiler Agriculture Zoology Poultry farming
116	For Immediate Release U.S. Poultry & Egg Association Contact Gwen Venable, , Research Provides Insight for Ventilation of Broiler Houses During Hot Weather Add to Reading List Source URL: www.uspoultry.org Language: English - Date: 2015-04-20 09:03:47 Broiler Food and drink Poultry farming Chicken U.S. Poultry & Egg Association
117	Regional 4-H Youth Poultry Shows (Broiler Meat Chickens, Laying Hens, Turkeys) Coordinator: Shea Ann DeJarnette & James Parsons Add to Reading List Source URL: www.robesoncountyfair.com Language: English - Date: 2014-09-05 00:15:55 Aviculture Meat Domesticated turkey Meleagrididae Poultry Broiler Turkey Poultry farming Agriculture Chicken
118	Aquaculture Europe 2011 Rhodes, 18-21 October 2011 Selective Breeding – Lessons learned from terrestrial animals and status of aquaculture implementation Marc Vandeputte Add to Reading List Source URL: www.easonline.org Language: English - Date: 2013-08-02 11:12:16 Poultry farming Biotechnology Selective breeding Breeding Meat Broiler Plant breeding Agricultural science Agronomy Biology Agriculture
119	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
120	For Immediate Release U.S. Poultry & Egg Association Contact Gwen Venable, , Still Water Farm Recognized for Environmental Excellence by USPOULTRY Add to Reading List Source URL: www.uspoultry.org Language: English - Date: 2015-02-09 14:57:38 Food and drink Land management U.S. Poultry & Egg Association Chicken Broiler Farmer Managed intensive rotational grazing Manure Agriculture Poultry farming Livestock

UPDATE