Methyltransferase - PDFSEARCH.IO - Document Search Engine

Methyltransferase
Results: 207

#	Item
51	Gao et al. Genome Biology 2012, 13:R100 http://genomebiology.comR100 RESEARCH Open Access Add to Reading List Source URL: www.genomebiology.com Language: English Molecular biology DNA Genomics Posttranslational modification Methylation DNA methylation DNA methyltransferase Methylated DNA immunoprecipitation Polymerase chain reaction Biology Genetics Epigenetics
52	6 Biological Science PF Activity Report 2008 #26 Recognition of Hemi-Methylated DNA by the SRA Protein UHRF1 Using a Base-Flipping Mechanism Add to Reading List Source URL: pfwww.kek.jp Language: English - Date: 2010-02-04 02:10:01 Molecular genetics DNA DNA methyltransferase DNA methylation Methylation Chromatin Methyltransferase CpG site Cytosine Biology Genetics Epigenetics
53	Cell, Vol. 43, , November 1985, Copyright Add to Reading List Source URL: micro.med.harvard.edu Language: English - Date: 2015-03-05 15:04:15 Mobile genetic elements Dam Transposable element Methylation Transposase Insertion sequence Point mutation Restriction enzyme Methyltransferase Biology Genetics Molecular biology
54	category primer sequence SSLP markers zC250L3F GGGTTTGTGAATGGAATGATG zC250L3R AGCGTCCACTGCTCAGAATC zC74M13F CCTCCTCCCAAAAACACATC Add to Reading List Source URL: jhoonline.org Language: English Chemistry Polymerase chain reaction Laboratory techniques DNA methyltransferase Biotechnology DNMT1 Real-time polymerase chain reaction Primer Biology Molecular biology Biochemistry
55	Targeted analysis of nucleotide and copy number variation by exon capture in allotetraploid wheat genome Add to Reading List Source URL: www.genomebiology.com Language: English Gene expression DNA Molecular biology Posttranslational modification DNA methylation Methylation Regulation of gene expression Bisulfite sequencing DNA methyltransferase Biology Genetics Epigenetics
56	Age-associated DNA methylation changes in immune genes, histone modifiers and chromatin remodeling factors within 5Łyears after birth in human blood leukocytes Add to Reading List Source URL: www.clinicalepigeneticsjournal.com Language: English DNA Molecular genetics Posttranslational modification DNA methylation Genomics CpG site Methylation CpG island DNA methyltransferase Genetics Biology Epigenetics
57	PDF Document Add to Reading List Source URL: www.sickkids.ca Language: English - Date: 2015-05-26 06:46:11 Chemistry Pharmacy Genomics Pharmacogenetics Genetics Thiopurine methyltransferase Thiopurine Mercaptopurine Personalized medicine Medicine Purines Pharmacology
58	Journal of Translational Medicine This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. miR-148b reverses cisplatin Add to Reading List Source URL: www.translational-medicine.com Language: English Chemistry A549 cell DNA methyltransferase A549 Cisplatin Mir-200 Non-small-cell lung carcinoma Epigenetics Genetics MicroRNA Biology
59	Epigenetics and developmental plasticity across species Add to Reading List Source URL: champagnelab.psych.columbia.edu Language: English - Date: 2013-08-13 12:12:14 Methylation DNA methylation Cellular differentiation Genomic imprinting Reprogramming DNA methyltransferase Epigenome Heredity Lamarckism Genetics Biology Epigenetics
60	Leveraging the Flexibility of Multi-color Imaging of Extremely Long SingleMolecules in NanoChannels for Epigenetic Profile Mapping, Centromere Probing by Hybridization and Sample Multiplexing Authors: A. Hastie1, DH. Zha Add to Reading List Source URL: www.bionanogenomics.com Language: English - Date: 2015-03-03 13:35:55 Molecular biology Genomics DNA Bisulfite sequencing DNA methyltransferase Methylation CpG site Sequencing Centromere Biology Genetics Epigenetics

UPDATE