DNMT1 - PDFSEARCH.IO - Document Search Engine

DNMT1
Results: 5

#	Item
1	Aus dem Institut für Biologie der Humboldt-Universität Berlin REGULATION OF DNA METHYLATION DURING DEVELOPMENT: ALTERNATIVE ISOFORMS OF DNA METHYLTRANSFERASE Add to Reading List Source URL: edoc.hu-berlin.de Language: English - Date: 2009-10-31 18:09:22 Genetics Biology Epigenetics Chemistry DNA methyltransferase DNMT1 DNA methylation Methyltransferase Methylation Cytosine Cellular differentiation
2	category primer sequence SSLP markers zC250L3F GGGTTTGTGAATGGAATGATG zC250L3R AGCGTCCACTGCTCAGAATC zC74M13F CCTCCTCCCAAAAACACATC Add to Reading List Source URL: jhoonline.org Language: English Chemistry Polymerase chain reaction Laboratory techniques DNA methyltransferase Biotechnology DNMT1 Real-time polymerase chain reaction Primer Biology Molecular biology Biochemistry
3	Lin and Wang Cell & Bioscience 2014, 4:46 http://www.cellandbioscience.com/contentREVIEW Cell & Bioscience Add to Reading List Source URL: www.cellandbioscience.com Language: English Epigenetics Proteins DNA Gene expression DNA methyltransferase DNA methylation DNMT1 DNMT3A DNMT3B Biology Genetics Transcription factors
4	Anti-AML activity of combined epigenetic therapy with novel DNMT1 inhibitors SGI-110 and SGI1036 and histone deacetylase inhibitor panobinostat. Warren Fiskus1, Pace Johnston1, Rajeshree Joshi1, Rekha Rao1, Celalettin Us Add to Reading List Source URL: astx.com Language: English Molecular biology Proteins DNA methyltransferase Developmental biology DNA methylation Actin K562 cells Cellular differentiation Histone deacetylase inhibitor Biology Genetics Epigenetics
5	[removed] Objec.ves CH3 v  Deﬁne epigene.cs Add to Reading List Source URL: www.ascls.org Language: English - Date: 2014-10-21 17:36:38 Proteins Tyrosine kinases Molecular genetics EZH2 PRC2 DNA methyltransferase Janus kinase 2 Histone DNMT1 Biology Genetics Epigenetics

UPDATE