SUPPLEMENT NO. 8 July 2012

First Page		Document Content
Date: 2014-01-04 01:36:18 Page Municipal Code Corporation CD36 Ordinance		SUPPLEMENT NO. 8 July 2012 Add to Reading List Source URL: www.cityofhunterscreek.com Download Document from Source Website File Size: 1,29 MB Share Document on Facebook

	Vol 450 \| 8 November 2007 \| doi:nature06328 LETTERS An essential role for a CD36-related receptor in pheromone detection in Drosophila Richard Benton1{, Kirsten S. Vannice1{ & Leslie B. Vosshall1 DocID: 1moQc - View Document
	Loss of SR-A and CD36 Activity Reduces Atherosclerotic Lesion Complexity Without Abrogating Foam Cell Formation in Hyperlipidemic Mice Jennifer J. Manning-Tobin, Kathryn J. Moore, Tracie A. Seimon, Susan A. Bell, Maia Sh DocID: 1m0yl - View Document
	Cell Metabolism Article Atherogenic Lipids and Lipoproteins Trigger CD36-TLR2-Dependent Apoptosis in Macrophages Undergoing Endoplasmic Reticulum Stress DocID: 1lgeu - View Document
	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA DocID: 18sFK - View Document
	This is an excerpt from Parasitic Diseases 5th Edition Visit www.parasiticdiseases.org for order information Fifth Edition Parasitic DocID: 17J8q - View Document