Names for JR blood group alleles v2Names for JR (ISBT 032) Blood Group Alleles General description: The JR blood group system consists of one antigen carried on a multipass membrane glycoprotein (a.k.a. ATP-bi

Source URL: www.isbtweb.org

• ABCG2
• Gene
• Exon
• Null allele
• Biology
• Genetics
• RNA splicing

Impact of ABCG2 polymorphisms on the clinical outcome of TKIs therapy in Chinese advanced non-small-cell lung cancer patients

Source URL: www.cancerci.com

• Quinazolines
• Amines
• Lung cancer
• Organofluorides
• Organochlorides
• Gefitinib
• Non-small-cell lung carcinoma
• Erlotinib
• ERCC1
• Chemistry
• Organic chemistry
• Medicine

Prediction of the Physicochemical and ADMET Properties of Indeno[1,2-b]Indole Derivatives as Potent ABCG2 Inhibitors GURAGOSSIAN Nathalie1 ; JABOR GOZZI Gustavo1,2 ; BOUAZIZ Zouhair1 ; WINTER Evelyn1,3 ; DAFLONYUNES Nath

Source URL: www.canceropole-clara.com

• In vivo
• ATP-binding cassette transporter
• Biology
• Clinical research
• Pharmaceutical industry
• In silico

Table 1s. Primer sequences used for RT-PCR analyses. Gene Size Primer Sequence (5’ to 3’) ABCG2 684 bp hABCG2-F gtttatccgtggtgtgtctgg hABCG2-R ctgagctatagaggcctggg

Source URL: www.grc.nia.nih.gov

• RE1-silencing transcription factor
• Zinc finger
• Biology
• Transcription factors
• Gene expression

5-fluorouracil (5FU) SLC22A7 ABCG2

Source URL: www.pharmgkb.org

Common variants in ABCG2 as a major cause of early-onset gout H. Matsuo1, K. Ichida2, T. Takada3, A. Nakayama1, H. Nakashima4, T. Nakamura5, Y. Kawamura1, Y. Takada6, S. Shimizu1, M. Sakiyama1, T. Chiba1, N. Hamajima7, Y

Source URL: aplarcongress.org

• Uric acid
• Gout
• Health
• Biology
• Rheumatology
• Medicine
• Nitrogen metabolism

Expressions of ABCG2, CD133, and Podoplanin in Salivary Adenoid Cystic Carcinoma

Source URL: www.ncbi.nlm.nih.gov

• Developmental biology
• Molecular biology
• Carcinogenesis
• CD133
• Side population
• Cancer stem cell
• Stem cell marker
• Carcinoma
• Cellular differentiation
• Biology
• Cell biology
• Stem cells