R1

Results: 3740



#Item
781

IARU Region 1 ATV ContestGlobal ranking : rank call 1 PE1NKT

Add to Reading List

Source URL: www.iaru-r1.org

Language: English - Date: 2015-04-22 05:42:48
    782Sirenians / Manatee / Gift

    Renewal Letter_R1_Aug2014_NewPerks.indd

    Add to Reading List

    Source URL: www.savethemanatee.org

    Language: English - Date: 2014-10-07 12:36:16
    783Electronic engineering / Letter beacon / Automatic link establishment / Types of radio emissions / Sideband / Ale / Amateur radio / Radio / Telecommunications engineering

    Monitoring System DK2OM – Wolf Hadel Co-ordinator of IARUMS Region 1 Editor of the Newsletter HB9CET – Peter Jost Vice Co-ordinator of IARUMS Region 1

    Add to Reading List

    Source URL: www.iarums-r1.org

    Language: English - Date: 2015-04-09 14:47:23
    784Real estate / Workforce housing / Development Bank of Southern Africa / Public housing / Government / Socioeconomics / Affordable housing / Housing / Community organizing

    R1b invested in affordable housing Cape Business News 17 October 2011 A global private equity investor has notched up a landmark R1 billion committed in the South African affordable housing market. International Housing

    Add to Reading List

    Source URL: www.urbanlandmark.org.za

    Language: English - Date: 2013-03-05 08:55:00
    785Application software / Modeling and simulation / Simulation software / Scientific modeling / Data collection / Software / Business simulation / One Semi-Automated Forces / Operations research / Simulation / Serious game

    2 February 2012 Alex Wright Assistant Director Technical Assessment Defence Export Control Office Department of Defence Russell Offices (R1-1-A111)

    Add to Reading List

    Source URL: www.simulationaustralia.org.au

    Language: English - Date: 2012-03-26 04:54:41
    786Standards organizations / Publishing / Academia / Institute of Electrical and Electronics Engineers / IEEE Nuclear and Plasma Sciences Society / IEEE Xplore / Open access / Engineering / International nongovernmental organizations / Professional associations

    13036-NPSS-WhyPublish-bi-reprint-R1.indd

    Add to Reading List

    Source URL: ieee-npss.org

    Language: English - Date: 2014-08-11 12:41:40
    787

    Table S1. Primer pairs used to amplify the fragments encompassing the targeted sites of IL2rg, RAG1, RAG2, TIKI1 and ALB. Primer IL2rg-F1 CCTGATGCCAGAGACACAAG IL2rg-R1 CCACTCCCCTACTCTGAAAATAC IL2rg-F2 GGAGGGAAGATCCAGAACT

    Add to Reading List

    Source URL: cellregenerationjournal.com

    Language: English
      788Performance Handicap Racing Fleet / 125

      2015 Newport to Cabo Race Newport Harbor Yacht Club R1 Start: Start 1, Finishes: Finish time, Time: @13:05:00 Start: Start 2, Finishes: Finish time, Time: @13:25:00 Start: Start 3, Finishes: Finish time,

      Add to Reading List

      Source URL: nhyccaborace.com

      Language: English - Date: 2015-03-26 11:43:45
      789

      HemligÅrsredovisning 2014 En utställning om Norrland under f ö r r1:a i kvärldskriget sarkivet Visas mellan 8 november 2014 och 30 april 2015

      Add to Reading List

      Source URL: riksarkivet.se

      Language: Swedish - Date: 2015-04-13 07:04:49
        790Transportation in Arlington County /  Virginia / Northern Virginia / Virginia Railway Express / Fredericksburg Line / Woodbridge / Quantico / Fredericksburg / Northeast Regional / Union Station / Transportation in the United States / Rail transportation in the United States / Richmond /  Fredericksburg and Potomac Railroad

        Main Level Living Ad_8.5x11_VREride_Ver4_r1.indd

        Add to Reading List

        Source URL: www.vre.org

        Language: English - Date: 2015-05-08 12:16:24
        UPDATE