Nucleotide - PDFSEARCH.IO - Document Search Engine

Nucleotide
Results: 1607

#	Item
561	Finding genes that expand waistlines Add to Reading List Source URL: medicalxpress.com Language: English - Date: 2015-02-10 15:35:35 Nutrition Obesity Population genetics FTO gene Single-nucleotide polymorphism Body mass index Genome-wide association study Asian people Melanocortin 4 receptor Biology Genetics Body shape
562	BMC Bioinformatics BioMed Central Open Access Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Mathematical optimization Cybernetics Genetics Computational neuroscience Molecular biology Epistasis Genetic algorithm Single-nucleotide polymorphism Heritability Biology Science Applied mathematics
563	HIV-1 RT heterodimer Human Immunodeficiency Virus1 Reverse Transcriptase recombinant, E. coli Cat. No. Add to Reading List Source URL: www.jenabioscience.com Language: English - Date: 2014-04-14 05:57:18 Reverse transcriptase Reverse-transcriptase inhibitor RNase H HIV Integrase Discovery and development of nucleoside and nucleotide reverse-transcriptase inhibitors Discovery and development of non-nucleoside reverse-transcriptase inhibitors Biology Molecular biology HIV/AIDS
564	PLOS One (Supplementary material) Lung cancer susceptibility model based on age, family history and genetic variants. Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Apoptosis Tumor necrosis factor receptor Proteins TNFRSF1A CTGF RAD52 Single-nucleotide polymorphism Interferon gamma receptor 2 XRCC4 Biology Molecular biology Biochemistry
565	Nucleotide Sequence for Inverse Pericam Note: numbering refers to amino acid residues, not nucleotides. Note: this sequence is directly preceded by a BamHI site w/frame-shift, G GAT CCG[removed]AAG AGG CGC TGG AAG AAA AAC Add to Reading List Source URL: openwetware.org Language: English - Date: 2007-12-13 14:30:00
566	dbSNP Entity Relationship Diagram: Build 125 Last updated: [removed]Note: 1. dbSNP Schema is very complex with well over 100 tables and many relationships among tables. One single ER diagram with all dbSNP tables will be Add to Reading List Source URL: ftp.ncbi.nlm.nih.gov Language: English - Date: 2006-01-13 13:50:00 Biological databases DNA Molecular biology Genetic genealogy DbSNP Single-nucleotide polymorphism Genotype frequency Population genetics Genetics Biology
567	Additonal file 4. Table S3 The average pairwise nucleotide and amino-acid distances (A), dN and dS for brown bear MHC class I sequences (B). Distances and standard error values are given as percentages per site; standar Add to Reading List Source URL: www.biomedcentral.com Language: English Amino acid Matter Genes Genetics Pseudogene
568	Nucleic Acids Research Advance Access published February 24, 2008 Nucleic Acids Research, 2008, 1–13 doi:[removed]nar/gkn081 The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenother Add to Reading List Source URL: nar.oxfordjournals.org Language: English DNA Gene expression Oenothera Genome Plastid Plastome Noncoding DNA Gene Ribosomal RNA Biology Genetics RNA
569	Additional file 5. Nucleotide sequences of MHC class II DRB genes in the Scandinavian brown bear. >Urar-DRB11 GTGCGGTACCTGGTCAGAGACATCTATAACGGGCAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCCATCGCTGA Add to Reading List Source URL: www.biomedcentral.com Language: English*
570	Microbiology (2011), 157, 260–269 DOI[removed]mic[removed]Biosynthesis of UDP-xylose and UDP-arabinose in Sinorhizobium meliloti 1021: first characterization Add to Reading List Source URL: bioenergycenter.org Language: English - Date: 2011-04-12 14:49:10 Carbohydrates Coenzymes Metabolism Nucleotide sugar Nucleotides UDP-glucose 6-dehydrogenase Chemistry Biology Carbohydrate chemistry

UPDATE