Nucleotide

Results: 1607



#Item
151Molecular biology / Population genetics / Biological databases / Single-nucleotide polymorphism / International HapMap Project / SNP genotyping / Nasopharyngeal carcinoma / Melanoma / Cervical cancer / Biology / Genetics / DNA

TLR3 gene polymorphisms in cancer: a systematic review and meta-analysis

Add to Reading List

Source URL: www.cjcjournal.com

Language: English
152Genetic genealogy / Classical genetics / Molecular biology / Single-nucleotide polymorphism / Genome-wide association study / Genetic association / Class / Genetics / Biology / Population genetics

Differences between snpStats and snpMatrix David Clayton April 16, 2015 The snpMatrix and snpStats packages The package “snpMatrix” was written to provide data classes and methods to facilitate the

Add to Reading List

Source URL: www.bioconductor.org

Language: English - Date: 2015-04-16 22:34:47
153International HapMap Project / DNA / Summary statistics / Single-nucleotide polymorphism / Variance / Weighted mean / Bias of an estimator / Estimator / Analysis of variance / Statistics / Population genetics / Molecular biology

Fst The algorithm used in snpStats David Clayton April 16, 2015 F statistics for diversity of groups

Add to Reading List

Source URL: www.bioconductor.org

Language: English - Date: 2015-04-16 22:34:47
154Classical genetics / Population genetics / Human genetics / Genetic genealogy / Genome-wide association study / Single-nucleotide polymorphism / Genetic association / Genetic heterogeneity / Human genome / Genetics / Biology / Philosophy of biology

Large-scale replication and heterogeneity in Parkinson disease genetic loci Manu Sharma, John P.A. Ioannidis, Jan O. Aasly, et al. Neurology; Published online before print July 11, 2012; DOIWNL.0b013e318264e353

Add to Reading List

Source URL: www.geopd.org

Language: English - Date: 2012-07-17 06:45:22
155Genome-wide association study / Single-nucleotide polymorphism / Association mapping / Biology / Genetics / Philosophy of biology

    

Add to Reading List

Source URL: cazencott.info

Language: English - Date: 2014-12-14 10:14:24
156Atlantic Ocean / Latitude of the Gulf Stream and the Gulf Stream north wall index / Global Innovation Index

2008 Paper 8 Question 1 Bioinformatics (a) Parameters of the positional independence of a transcription factor binding site were estimated by the experimental positional nucleotide frequencies shown in the following tab

Add to Reading List

Source URL: www.cl.cam.ac.uk

Language: English - Date: 2014-06-09 10:18:25
157RNA splicing / Mutation / Biology / Genetics / RHD

D negative null alleles v2RHD negative i.e. null Phenotype Allele name Nucleotide

Add to Reading List

Source URL: www.isbtweb.org

Language: English - Date: 2014-12-29 10:36:26
158Classical genetics / Population genetics / Non-parametric statistics / Genetic genealogy / Genetic linkage / Histogram / Single-nucleotide polymorphism / Genetics / Biology / Statistics

TDT vignette Use of snpStats in family–based studies David Clayton April 16, 2015 Pedigree data

Add to Reading List

Source URL: www.bioconductor.org

Language: English - Date: 2015-04-16 22:34:47
159

Nucleotide Sequence of pCMV6-Kan/NEO AACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGT

Add to Reading List

Source URL: www.origene.com

Language: English - Date: 2007-12-07 15:42:17
    160Genetic epidemiology / Genome-wide association study / Population genetics / Single-nucleotide polymorphism / Lasso / Biology / Genetics / Genetic genealogy

    Efficiently mapping phenotypes to networks of genetic loci Chlo´ e-Agathe Azencott1, Dominik Grimm1, Yoshinobu Kawahara 2 and Karsten Borgwardt1,3 1Machine Learning and Computational Biology Research Group, Max Planck I

    Add to Reading List

    Source URL: cazencott.info

    Language: English - Date: 2014-12-14 10:21:03
    UPDATE