ARTICLE pubs.acs.org/JPCA TD-CI Simulation of the Electronic Optical Response of Molecules in Intense Fields II: Comparison of DFT Functionals and EOM-CCSD Jason A. Sonk and H. Bernhard Schlegel*

Source URL: chem.wayne.edu

• Hybrid functional
• Time-dependent density functional theory
• Crystal
• Chemistry
• Density functional theory
• Physics

< PAGE >VII molecular data 4.2 (May 2002) < DATE > Version 4.2 (MayConstants for molecules of astrophysical interest in the gas phase: photodissociation,

Source URL: www.lesia.obspm.fr

• Refrigerants
• Bases
• HCNH+
• Astrochemistry
• Hydroxyl radical
• Ethynyl radical
• Hydrogen
• Hydroxide
• Hydronium
• Chemistry
• Cations
• Free radicals

Research Articles Control of Superstructures of Liquid-Crystalline Molecules Using Lateral Intermolecular Interactions | TCI

Source URL: www.tcichemicals.com

• Chemical bonding
• Intermolecular forces
• Soft matter
• Phase transitions
• Columnar phase
• Mesogen
• Properties of water
• Chemical polarity
• Hydrogen bond
• Chemistry
• Matter
• Liquid crystals

Humic Materials for Agriculture By R.L. Mikkelsen Humic materials…very large and complex molecules extracted from organic matter…have been used in many ways for plant production. There are numerous reports of plant r

Source URL: ucanr.org

• Soil
• Organic gardening
• Soil science
• Humic acid
• Soil chemistry
• Humus
• Leonardite
• Chelation
• International Humic Substances Society
• Agriculture
• Chemistry
• Composting

The Science behind the Show All matter (i.e. everything) in the universe is made up of tiny particles (atoms and molecules). Whether that matter is a solid, liquid or a gas depends on how these particles are behaving. Pa

Source URL: www.sciencefestival.co.uk

• Inorganic solvents
• Oxides
• Liquids
• Phases of matter
• State functions
• Gas
• Ice
• Properties of water
• Temperature
• Chemistry
• Matter
• Physics

IGER-ACP-ITbM-RCMS Seminar Prof. Chunyan Chi National University of Singapore “Soluble and Stable Acene Based Molecules and Materials” January 20, 2015 (Tue) 16:30–18:00

Source URL: www.rcms.nagoya-u.ac.jp

Biology Biology is the study of living things. Biologists study life from molecules to ecosystems. At Stetson, students may obtain either a bachelor of science degree or a bachelor of arts degree in biology. In both majo

Source URL: www.stetson.edu

• Florida
• Higher education
• Brandeis University Graduate School of Arts and Sciences
• Virginia Polytechnic Institute and State University
• Stetson University
• Academia

Hydrogen Trapping through Designer Hydrogen Spillover Molecules with Reversible Temperature and Pressure-Induced Switching - DOE Hydrogen and Fuel Cells Program FY 2014 Annual Progress Report

Source URL: www.hydrogen.energy.gov

• Colloidal chemistry
• Crystal engineering
• Metal-organic framework
• Hydrogen storage
• Adsorption
• Hydrogenation
• Chemisorption
• Hydrogen
• Physisorption
• Chemistry
• Catalysis
• Surface chemistry

Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and

Source URL: rw.mammoth.psu.edu

• Genetics
• DNA
• Biotechnology
• Base pair
• Nucleic acid sequence
• Complementarity
• Pyrosequencing
• Polymerase chain reaction
• 454 Life Sciences
• Biology
• Molecular biology
• DNA sequencing

Surface and Interface 11C/2003G087 Controlling Orientation of phthalocyanine molecules by use of PTCDA ultra-thin templete layer

Source URL: pfwww.kek.jp

• Photon
• Physics
• Emission spectroscopy
• Photoemission spectroscopy