Microsatellite - PDFSEARCH.IO - Document Search Engine

Microsatellite
Results: 1006

#	Item
41	doi:j.fsigen Add to Reading List Source URL: www.cstl.nist.gov Language: English - Date: 2008-12-15 13:09:21 Biology Molecular biology Chemistry Polymerase chain reaction Laboratory techniques Biochemistry DNA Biotechnology Multiplex polymerase chain reaction Microsatellite STR analysis DNA profiling
42	Conservation Genet Resour:197–199 DOIs12686TECHNICAL NOTE First microsatellite panel for the Wood Tiger Moth Add to Reading List Source URL: users.jyu.fi Language: English - Date: 2011-10-27 09:55:58
43	A High-Throughput Method to Detect Privacy-Sensitive Human Genomic Data Vinicius V. Cogo1 , Alysson Bessani1 , Francisco M. Couto1 , and Paulo Verissimo2 1 LaSIGE, Faculdade de Ciências, Universidade de Lisboa, Portuga Add to Reading List Source URL: www.di.fc.ul.pt Language: English - Date: 2015-07-29 18:58:54 Molecular biology Genomics DNA Biotechnology Genetics Human genome Microsatellite DNA sequencing Single-nucleotide polymorphism Bioinformatics DNA database Functional genomics
44	In Silico identification of pathogenic strains of Cronobacter from Biochemical data reveals association of inositol fermentation with pathogenicity Add to Reading List Source URL: www.quailresearch.org Language: English - Date: 2015-04-20 15:01:38 Biology Molecular biology Chemistry Biochemistry Polymerase chain reaction Laboratory techniques DNA Amplifiers Internal transcribed spacer Microsatellite Real-time polymerase chain reaction Primer
45	Table 1 Microsatellite primers for constructing RH map Chromosome Marker name Forward primer 1 S0008 gaggcagtgtgttctattca 1 Add to Reading List Source URL: ssrh.gene.staff.or.jp Language: Italian - Date: 2002-12-23 22:11:26
46	bonnethead sharks (Sphyrna tiburo, family: Sphyrnidae (hammerhead sharks)) gave birth to a normally developed, live female pup which was apparently later killed by another fish in the aquarium. This birth is significant Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Reproduction Sphyrnidae Parthenogenesis Bonnethead Asexual reproduction Hammerhead shark Genomic imprinting Microsatellite Shark Fish Biology Genetics
47	Forensic Science International–51 www.elsevier.com/locate/forsciint Individualization of tiger by using microsatellites Yan Chun Xua,b,, Bo Lia, Wan Shui Lic, Su Ying Baia, Yu Jina, Xiao Ping Lid, Ming B Add to Reading List Source URL: www.globaltigerforum.com Language: English* - Date: 2012-10-30 12:30:12 Philosophy of biology DNA Molecular biology Statistical genetics Microsatellite Zygosity Genetic linkage DNA profiling Population genetics Genetics Biology Classical genetics
48	Microsoft Word - Progress report 2008.doc Add to Reading List Source URL: archive-ecpgr.cgiar.org Language: English - Date: 2014-11-05 07:01:04 Botany Vitis Grape Sales Tax Management Services Plant breeding Microsatellite Vitis International Variety Catalogue Viticulture Biology Agriculture
49	Mitchell Bekritsky     Address:  Add to Reading List Source URL: schatzlab.cshl.edu Language: English - Date: 2012-07-10 22:25:42 Bioinformatics RNA Biology Genetics Microsatellite
50	Genetic diversity and breeding of teak in Myanmar Yazar Minn Ph.D. Forest Botany and Tree Improvement Section Forest Research Institute Add to Reading List Source URL: www.worldteakconference.com Language: English - Date: 2015-06-17 12:15:42 Wood Teak Microsatellite Deforestation Biodiversity Earth Biology Environment Forestry