FUS

Results: 361



#Item
191Molecular biology / Cytogenetics / Fusion gene / Mutation / FUS / Chromosomal translocation / Multiplex / Fluorescence in situ hybridization / Ewing sarcoma breakpoint region 1 / Biology / Genetics / Laboratory techniques

Sarcoma FUSIONPlex Archer™ FusionPlex™ Sarcoma Panel Includes the following genes and their fusion partners:

Add to Reading List

Source URL: archerdx.com

Language: English - Date: 2015-02-06 18:17:14
192DNA sequencing / Chemistry / Laboratory techniques / Biotechnology / Microarrays / Illumina / Fusion / FUS / Multiplex / Biology / Molecular biology / Biochemistry

Instructions for Use Archer™ FusionPlex™ Sarcoma Panel AK0032-8 Description

Add to Reading List

Source URL: archerdx.com

Language: English - Date: 2015-02-19 18:39:01
193Chairs / Oxygen / Cardiovascular physiology / Respiratory physiology / Diving medicine / Perfusion / Wheelchair / Bedsore / Carbon dioxide / Chemistry / Medicine / Matter

Improving Oxygen Flow While Seated HOW TH E E M BODY® CHAI R’S DE S IG N PROMOTE S TI SS U E PE R FUS ION In a world where sitting is more prevalent in the workplace than ever, discomfort can become all

Add to Reading List

Source URL: www.daytradinglife.com

Language: English - Date: 2013-02-02 14:28:55
194

cDNA cloning primers FUS_F_EcoRI GTTGGAATTCGTTGCTTGCTT FUS_R_BamHI TATGGATCCATACGGCCTCTCCCTGCGATCCTG FUSA_F_XhoI TATACTCGAGCGCGGACATGGCCTCAAACG FUSA_R_BamHI TATTGGATCCACTCCACCTCCACCTC

Add to Reading List

Source URL: www.biomedcentral.com

    195RNA / Molecular biology / Gene expression / Protein biosynthesis / MRNA display / Translation / FUS / Peptide / LSm / Biology / Genetics / Biochemistry

    Microsoft Word - 04_PNAS.doc

    Add to Reading List

    Source URL: thesis.library.caltech.edu

    Language: English - Date: 2012-12-25 21:46:58
    196

    Aktion Heugabel: Eine Erfolgsgeschichte Im ersten Jahr nach der Gründung konnten die Organisatoren der Aktion Heugabel 13 Bauern und 147 Mitarbeiter gewinnen. Die Idee fasste also sofort Fuß. Im Laufe der folgenden Jah

    Add to Reading List

    Source URL: www.frastanz.at

    Language: German - Date: 2011-07-18 08:25:19
      197

      VIII. österr. Fachkonferenz für FußgängerInnen[removed]Tagungsbeiträge auf CD Unter dem Motto: “Zu Fuß nachhaltig aktiv mobil - Bewegung & Begegnung” fand die VIII. österreichische Fachkonferenz für Fußgänger

      Add to Reading List

      Source URL: www.walk-space.at

      Language: German - Date: 2014-10-21 12:40:54
        198

        Behandlung Dauer/MINUTEN Preis/CHF Massagetherapien Indische Kopfmassage 45 135 Fuß-Akupressur

        Add to Reading List

        Source URL: www.thealpinagstaad.ch

        Language: German - Date: 2014-12-03 03:21:01
          199

          Fachkonferenz für FußgängerInnen[removed]Bodensee “gut zu Fuß - vital begegnet” - nachhaltig aktive Personenmobilität in der Mobilitätskette 18. und 19. Mai 2015 | Bregenz, vorarlberg museum IX. FußgängerInn

          Add to Reading List

          Source URL: www.walk-space.at

          Language: German - Date: 2015-02-02 07:27:40
            200

            Region Mitte (AG-LU-ZG-Innerschweiz) Montag, [removed], 9:00 – 11:00 Uhr Gasthaus die Perle, Dorfstrasse 17, 6035 Perlen Region Ost (SH-ZH-TG-SG-GR) Montag, [removed], 15:00 – 17:00 Uhr Graubünden Holz, Foyer, Bahnhofpl

            Add to Reading List

            Source URL: www.fus-efs.ch

            Language: German - Date: 2014-12-19 10:31:01
              UPDATE