4mtD3cpv in pcDNA3; 5’HindIII, 3’EcoRI AAGCTTATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTGGGGGATCCCATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAG

Source URL: www.tsienlab.ucsd.edu

Microsoft Word[removed]13_FinfishSectorMgmtPlan2014_ERLID7444

Source URL: www.ecori.org

• Overfishing
• Stock assessment
• Atlantic States Marine Fisheries Commission
• Fisheries management
• Discards
• Fish stock
• Tautog
• Menhaden
• Commercial fishing
• Fish
• Fisheries science
• Clupeidae

2010 NORTHEASTERN NATURALIST 17(1):77––90

Source URL: www.ecori.org

• Aquatic ecology
• Earth
• Biological oceanography
• Fisheries
• Spring bloom
• Mesocosm
• IPCC Fourth Assessment Report
• Current sea level rise
• Rhode Island
• Oceanography
• Water
• Effects of global warming

When retreat is the better part of valor: Analysis of Strategies to Incentivize Retreat from the Shore http://www.reuters.com/article[removed]usstorm-sandy-matunuck-idUSBRE89U02A20121031 http://www.ecori.org/front-pa

Source URL: law.rwu.edu

• Eastern United States
• Coastal geography
• Misquamicut State Beach
• Beach
• Matunuck
• Rhode Island
• Milford
• Connecticut
• Westerly
• Rhode Island
• Geography of the United States
• Rhode Island

Analysis of S.379 An Act Improving Recycling in the Commonwealth, so-called An analysis of the effects of passage of S.379 on litter, recycling, employment,

Source URL: www.ecori.org

• Recycling
• Containers
• Packaging
• Waste containers
• Container deposit legislation in the United States
• Container deposit legislation
• Litter
• Recycling bin
• Keep America Beautiful
• Waste management
• Sustainability
• Environment

EcoRI (396bp) SacI (406bp) KpnI (412bp) SloxM1 MluI (482bp) NotI (489bp)

Source URL: www.biosupport.kazusa.or.jp

Map of the FSHD-linked D4Z4 repeat array and proximal regions: Essentially the same structures are seen at 4q35 and 10q26 Proximal to D4Z4 p13E-11

Source URL: www.fshsociety.org

• Genetics
• Facioscapulohumeral muscular dystrophy
• Muscular dystrophy
• Hybridization probe
• Restriction fragment length polymorphism
• EcoRI
• Chromosome 4
• Deletion
• Biology
• Molecular biology
• Health

EcoRI (396bp) VCre pUCNLS-VCre (3911bp)

Source URL: www.biosupport.kazusa.or.jp

EcoRI (437bp) EcoRI (396bp) SCre Amp R

Source URL: www.biosupport.kazusa.or.jp

Math and Science @ Work - Educator Edition

Source URL: www.nasa.gov

• Restriction enzyme
• Restriction map
• DNA
• Plasmid
• Genetics
• Gel electrophoresis
• Restriction site
• Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid
• EcoRI
• Biology
• Molecular biology
• Biochemistry