ECOMMERCE CASE STUDY: AMPLIFY Who they are Amplify is a company that is passionate about improving the educaonal process and its results for teachers and students alike. The company offers data-driven educaonal curric

Source URL: www.nexternal.com

• Business
• Web applications
• Web development
• Cloud applications
• Salesforce.com
• Online shopping
• Electronic commerce
• Computing
• Information technology management

Women, energy, and economic empowerment Applying a gender lens to amplify the impact of energy access

Source URL: d2mtr37y39tpbu.cloudfront.net

• Science
• Gender inequality
• Gender
• Land law
• Energy poverty
• United Nations International Research and Training Institute for the Advancement of Women
• Feminization of poverty
• Sociology
• Social philosophy
• Empowerment

MIDEAST YOUTH CREATING PLATFORMS THAT AMPLIFY VOICES ADVOCATING CHANGE Project URL: mideastyouth.com Project Twitter: @MideastYouth Organisation URL: http://www.mideastyouth.com/ Organisation Twitter: @@MideastYouth

Source URL: socialtech.org.uk

• Mideast Youth
• Empowerment
• Structure
• Social change
• Sociology
• Non-governmental organizations
• Social entrepreneurship
• Social media

Accelerate to Amplify Biotechnology Industry Research Assistance Council (A Government of India Enterprise) December 2014

Source URL: venturecenter.co.in

• Private equity
• Venture capital
• Biotechnology

AMPLIFY CONTENT, TURN UP DEMAND. The Complete Insider’s Guide To Promote Your Content And Reach A Larger Audience Feldman Creative and CoSchedule CoSchedule © 2015

Source URL: feldmancreative.com

• Internet marketing
• Social media
• Social information processing
• Mass media
• Editorial calendar
• Twitter
• Advertising
• Content marketing
• Search engine optimization
• Marketing
• Business
• World Wide Web

Science Won’t Speak For Itself! Amplify Your Research and Get Noticed A companion e-book and checklist of PR tools for scientists © 2013 BioData Ltd. All rights reserved. Content may be copied for personal use. It ma

Source URL: assets.labguru.com

• National Institutes of Health
• Nursing research
• Science
• Health
• Medicine
• Bethesda
• Maryland
• Cancer research

Manufacturing High Titer Lysates OBJECTIVE To amplify the phage and obtain a high titer lysate. BACKGROUND A plate lysate is simply a concentrated liquid sample of phage. It is obtained by infecting a plate of bacteria w

Source URL: phagesdb.org

• Caudovirales
• Lambda phage
• Bacteriophages
• Microbiology
• Biology

Table S1. Primer pairs used to amplify the fragments encompassing the targeted sites of IL2rg, RAG1, RAG2, TIKI1 and ALB. Primer IL2rg-F1 CCTGATGCCAGAGACACAAG IL2rg-R1 CCACTCCCCTACTCTGAAAATAC IL2rg-F2 GGAGGGAAGATCCAGAACT

Source URL: cellregenerationjournal.com

Social tool kit This toolkit is designed to inform and help you amplify discussion and chatter surrounding the ITS World Congress before, during and after the event. Our team will be leveraging several key platforms (Twi

Source URL: 3wkxa1tki07n1g5d2y4oit18.wpengine.netdna-cdn.com

• Information
• Social media
• Web 2.0
• Real-time web
• Text messaging
• Bitly
• Hashtag
• Facebook
• World Wide Web
• Twitter
• Computing

Amplify sponsoR RateS Quick View Top Spot Second Spot

Source URL: www.ampthemag.com

• Video overlay
• Web banner
• Computing